|
Cytoskeleton Inc
machine learning identified rac1 cytoskeleton signaling transduction Machine Learning Identified Rac1 Cytoskeleton Signaling Transduction, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/Rac1%2C2%2C3+G-LISA+GTPase+Activation+Assay/pmc12208828-137-2-6 Average 93 stars, based on 1 article reviews
machine learning identified rac1 cytoskeleton signaling transduction - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
prk5 rac1 v12 Prk5 Rac1 V12, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/Rac+1/pm18506888-43-15-13 Average 95 stars, based on 1 article reviews
prk5 rac1 v12 - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
OriGene
agatgcaggccatcaagtgt ![]() Agatgcaggccatcaagtgt, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/RAC1+(NM_006908)+Human+3'+UTR+Clone/pmc07086357-29-6-8 Average 90 stars, based on 1 article reviews
agatgcaggccatcaagtgt - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Cytoskeleton Inc
rac 1 protein levels ![]() Rac 1 Protein Levels, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/Rac1+GST+Protein/pmc09205595-148-22-39 Average 90 stars, based on 1 article reviews
rac 1 protein levels - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Cytoskeleton Inc
active rac 1 ![]() Active Rac 1, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/Rac1+Pull-down+Activation+Assay+Biochem+Kit/pm28147279-207-0-17 Average 95 stars, based on 1 article reviews
active rac 1 - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Cytoskeleton Inc
rac 1 protein ![]() Rac 1 Protein, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/Rac1+His+Protein/pm36165184-61-19-32 Average 90 stars, based on 1 article reviews
rac 1 protein - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Cytoskeleton Inc
rac1 activation assays rac 1 activity ![]() Rac1 Activation Assays Rac 1 Activity, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/Rac1+G-LISA+Activation+Assay+Kit/pm26824863-87-0-13 Average 95 stars, based on 1 article reviews
rac1 activation assays rac 1 activity - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
OriGene
myc raco 1 plasmid ![]() Myc Raco 1 Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/RAC1+(NM_006908)+Human+Tagged+ORF+Clone/pm32896069-25-1-6 Average 90 stars, based on 1 article reviews
myc raco 1 plasmid - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rac1 ![]() Rac1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/Rac+1%2F2%2F3+Antibody/pmc08526568-242-10-11 Average 93 stars, based on 1 article reviews
rac1 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
rac 1 ![]() Rac 1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/Rac1%2F2%2F3+Antibody/pmc10079967-92-40-42 Average 95 stars, based on 1 article reviews
rac 1 - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Cytoskeleton Inc
rac 1 antibody ![]() Rac 1 Antibody, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/machine+learning+identified+rac1+cytoskeleton+signaling+transduction/Anti-Rac1+specific+mouse+MAb/pmc03155765-55-1-6 Average 94 stars, based on 1 article reviews
rac 1 antibody - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Theranostics
Article Title: Serelaxin alleviates cardiac fibrosis through inhibiting endothelial-to-mesenchymal transition via RXFP1
doi: 10.7150/thno.38640
Figure Lengend Snippet: Primers used in qPCR assay for gene expression analysis
Article Snippet: , Rac1 , F: TCTCCAGGAAATGCATTGGT R:
Techniques: Gene Expression, Sequencing
Journal: Science Advances
Article Title: BACE-1 inhibition facilitates the transition from homeostatic microglia to DAM-1
doi: 10.1126/sciadv.abo1286
Figure Lengend Snippet: ( A and B ) WT and Bace-1 –null BMDM were treated with Aβ for 30 min, and Rac-1 activity was determined using the PBD pulldown assay, followed by immunoblotting with an anti–Rac-1 antibody. The bar graph in (B) shows elevation of Rac-1 activity in Bace-1 –null BMDM ( N = 3, ** P < 0.01, Student’s t test). ( C ) Elevated ROS levels in WT and Bace-1 –null BMDM measured spectrophotometrically by changes in DCFDA fluorescence 30 min after Aβ treatment. ( D to F ) Immunoblot panel and quantification for phosphorylated PI3K (pPI3K) and pAKT, as performed on lysates from WT and Bace-1 –null BMDM treated with Aβ (1 μM) for the indicated time points. There was significant up-regulation of pPI3K and pAKT as early as 30 min after Aβ treatment ( N = 3, ** P < 0.01, Student’s t test). ( G and H ) Levels of full-length IL-1R2 and TLR4 in the cortex of Bace-1 –null brains were elevated, but TLR2 levels were slightly increased ( N = 3 independent experiments, ** P < 0.01 and * P < 0.05, Student’s t test), likely related to abolished cleavage of these proteins by BACE-1.
Article Snippet: To test whether Bace-1 deletion would alter Rac-1 activity, we used BMDM cells derived from WT and Bace-1 –null mice to measure
Techniques: Activity Assay, Western Blot, Fluorescence
Journal: Science Advances
Article Title: BACE-1 inhibition facilitates the transition from homeostatic microglia to DAM-1
doi: 10.1126/sciadv.abo1286
Figure Lengend Snippet: BACE-1 regulates the neuroinflammatory response through signaling from TLRs and IL-1R2, which are a potential BACE-1 substrate. The abolished or inhibited cleavage of these type 1 transmembrane proteins by BACE-1 will likely increase its signaling activity. Therefore, BACE-1 deletion or inhibition enhances TLR2 or TLR4 and IL-1β signaling activity, which further increases the subsequent phosphorylation of the downstream molecule p38 MAPK. Activated MAPK will increase phosphorylation and nuclear translocation of TFs such as Jun and Fos . In addition, BACE-1 also regulates Aβ-induced PI3K and downstream Rac-1 signaling associated with actin remodeling, endocytosis, and phagocytosis. Activation of these signaling pathways may also facilitate lysosomal functions.
Article Snippet: To test whether Bace-1 deletion would alter Rac-1 activity, we used BMDM cells derived from WT and Bace-1 –null mice to measure
Techniques: Activity Assay, Inhibition, Translocation Assay, Activation Assay
Journal: Nature Communications
Article Title: Regulation of local GTP availability controls RAC1 activity and cell invasion
doi: 10.1038/s41467-021-26324-6
Figure Lengend Snippet: a Cells transduced with the indicated constructs (Cl sh control shRNA, IMsh IMPDH2 shRNA, IM-LCK IMPDH2 with LCK membrane-localization domain, IM-GIA IMPDH2 with giantin Golgi localization domain) were separated into the plasma membrane and cytoplasm fractions as described in Methods, followed by immunoblotting with the indicated antibodies Shown are representative images of at least two independent experiments. b Immunofluorescence analysis for IMPDH2 (red) and actin (phalloidin, green), and nuclei (Hoechst, blue) in MDA-MB-231 cells transduced with the indicated constructs. Arrows denote the presence of IMPDH2 at the cell plasma membrane. Scale bar 20 µm. Shown are representative images of two independent experiments. c GTP levels were determined via mass spectroscopy as described in Methods. The data represents average ± SEM of two independent experiments performed in duplicates. Statistics performed by two-tailed unpaired Student’s t -test (**** p < 0.0001), exact p value <0.00001 for both cases. d Quantification of GEVAL activity in cell bodies (CB) and cell protrusions (CP) of MDA-MB-231 cells transduced with the indicated constructs and with GEVAL30 or GEVALNull (30 CBs and 30 CPs per cell type). Horizontal bars represent average. Individual values are from two experiments (15 CB and 15CP per experiment). Statistics were performed by a two-tailed unpaired Student’s t -test. e Cells transduced with the indicated constructs were probed in RAC1 activity assay as described in Methods. Shown are representative images of three independent experiments. f Quantification of ( e ). The data represents the average ± SEM of three independent experiments. Statistics were performed by a two-tailed unpaired Student’s t -test. g Invasion assay of MDA-MB-231 cells transduced with the indicated constructs. The data represents the average ± SEM of three independent experiments performed in duplicates. Statistics were performed by two-tailed unpaired Student’s t -test.
Article Snippet: Immunoprecipitation was performed using the following antibodies: IMPDH2 (Abcam, ab129165),
Techniques: Transduction, Construct, Control, shRNA, Membrane, Clinical Proteomics, Western Blot, Immunofluorescence, Mass Spectrometry, Two Tailed Test, Activity Assay, Invasion Assay
Journal: Nature Communications
Article Title: Regulation of local GTP availability controls RAC1 activity and cell invasion
doi: 10.1038/s41467-021-26324-6
Figure Lengend Snippet: a Schematic representation of the RAC1 FRET (Förster resonance energy transfer) biosensor. CRIB Cdc42/Rac interactive binding motif. b MDA-MB-231 cells co-expressed the RAC1 biosensor and GEVAL30 or GEVALNull. The signal of each individual biosensor was imaged and rendered as described in Methods . c MDA-MB-231 cells co-expressed the RAC1 biosensor and GEVAL30 or GEVALNull as in ( b ) and assayed for the correlation between biosensor activities. For each cell, biosensor data were collected in a series of images taken at 1-min intervals over the course of 30 min and analyzed as described in Methods. Pixel-wide Pearson correlation between RAC1 activity (measured as FRET (Förster resonance energy transfer) index for the RAC1 biosensor) and GTP index (measured as the activity of the indicated GEVAL variant) was calculated for each image. The correlation values for the image series corresponding to each individual cell were summarized as “bar-and-whiskers” plots, with “whiskers” indicating the first and the fourth quartiles, the horizontal line (median) splitting the bars into the second and the third quartiles, and “X” indicating quartiles, as well as the mean correlation coefficient ( r ) for each series. The mean correlation coefficients were compared by Mann–Whitney test. d Cells expressing the indicated constructs were probed in RAC1 activity assay as described in Methods. Note that the difference in migration of RAC1 T17N compared to other proteins is likely due to the fact that RAC1 T17N is fused to one Myc-tag, whereas other RAC1 proteins—to two Myc tags. Shown are representative images of at least two independent experiments. e Quantification of ( d ); n = 2 biologically independent samples (left panel); n = 3 biologically independent samples (right panel) The data represents average ± SEM.
Article Snippet: Immunoprecipitation was performed using the following antibodies: IMPDH2 (Abcam, ab129165),
Techniques: Förster Resonance Energy Transfer, Binding Assay, Activity Assay, Variant Assay, MANN-WHITNEY, Expressing, Construct, Migration
Journal: Nature Communications
Article Title: Regulation of local GTP availability controls RAC1 activity and cell invasion
doi: 10.1038/s41467-021-26324-6
Figure Lengend Snippet: a Cells were transduced with the indicated constructs and subjected to immunoprecipitation with the antibodies indicated on the top. The immunoprecipitated materials were probed in immunoblotting with the antibodies indicated on the left. Shown are representative images of at least two independent experiments. b Cells were fixed with ice-cold methanol and separated into cell bodies (CB) or cell protrusions (CP) fractions, followed by immunoblotting with the indicated antibodies. Shown are representative images of two independent experiments. c Proximity ligation assay was performed on sparsely plated cells with the antibodies indicated on the top. Shown are representative images of two independent experiments. d Schematic representation of IMPDH2 deletion mutants. Shown are Bateman domain consisting of two cystathionine-β-synthase sequences (CBS). e Indicated GST-tagged recombinant IMPDH2 mutants were incubated with recombinant 6xHis-tagged RAC1 (shown on the top), followed by immunoprecipitation with anti-GST tag antibodies and immunoblotting with anti-RAC1 antibodies. Shown are representative images of two independent experiments. f Recombinant full-length IMPDH2 and RAC1 proteins were cross-linked followed by mass spectroscopy as described in Methods. Shown are intra-proteins cross-linked peptides identified with highest confidence. Highlighted in red are cross-linked lysines. Shown are representative gel images of at least two independent experiments.
Article Snippet: Immunoprecipitation was performed using the following antibodies: IMPDH2 (Abcam, ab129165),
Techniques: Transduction, Construct, Immunoprecipitation, Western Blot, Proximity Ligation Assay, Recombinant, Incubation, Mass Spectrometry
Journal: Nature Communications
Article Title: Regulation of local GTP availability controls RAC1 activity and cell invasion
doi: 10.1038/s41467-021-26324-6
Figure Lengend Snippet: a Structures of RAC1 (shown in green) in complex with other indicated proteins (shown in blue). The number in parenthesis indicates the corresponding entry in RCSB (Research Collaboratory for Structural Bioinformatics) Protein Data Bank. Note that RAC1 binds to α-helices (shown in red) in the target proteins. b A model of the IMPDH2–RAC1 interaction was created by superimposing the α-helix of IMPDH2 containing K134 (shown in red) onto the analogous helix in the RAC1-Kalirin complex. c Convolved evolutionary coupling of IMPDH2 and RAC1. Strength of the couplings between residues of the two proteins are color-coded with red color denoting the highest probability. Shown in colored frames are regions with a high (green), intermediate (yellow), and low (blue) probability of interactions. d Cells were transduced with control shRNA (Cl sh), IMPDH2 shRNA (IMsh), or IMPDH2 shRNA in combination with wild-type IMPDH2 (IM WT ), IMPDH2 lacking 153-225 aa (IMΔ1), or IMPDH2 lacking 101-134 aa (IMΔ2). Cells were subjected to immunoprecipitation with the antibodies indicated on the top. The immunoprecipitated materials were probed in immunoblotting with the antibodies indicated on the left. Shown are representative images of at least two independent experiments. e GTP levels were determined via mass spectroscopy as described in Methods. The data represents the average ± SEM of two independent experiments performed in duplicates. Statistics performed by two-tailed unpaired Student’s t -test (**** p < 0.0001), exact p value < 0.00001. The data represents the average ± SEM of two independent experiments performed in duplicates. f Cells transduced with the indicated constructs were probed in RAC1 activity assay as described in Methods. Shown are representative images of at three independent experiments. g Quantification of ( f ). The data represents the average ± SEM of three independent experiments. Statistics were performed by a two-tailed unpaired Student’s t -test.
Article Snippet: Immunoprecipitation was performed using the following antibodies: IMPDH2 (Abcam, ab129165),
Techniques: Transduction, Control, shRNA, Immunoprecipitation, Western Blot, Mass Spectrometry, Two Tailed Test, Construct, Activity Assay